ID: 974205111

View in Genome Browser
Species Human (GRCh38)
Location 4:58691906-58691928
Sequence CAGTGCCAAGGTAATTCAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974205108_974205111 8 Left 974205108 4:58691875-58691897 CCTTATATTTTTGGTCAATTAAT No data
Right 974205111 4:58691906-58691928 CAGTGCCAAGGTAATTCAATGGG No data
974205107_974205111 9 Left 974205107 4:58691874-58691896 CCCTTATATTTTTGGTCAATTAA No data
Right 974205111 4:58691906-58691928 CAGTGCCAAGGTAATTCAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974205111 Original CRISPR CAGTGCCAAGGTAATTCAAT GGG Intergenic
No off target data available for this crispr