ID: 974211613

View in Genome Browser
Species Human (GRCh38)
Location 4:58783941-58783963
Sequence TAATTTTACTAAAGAGCATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974211610_974211613 6 Left 974211610 4:58783912-58783934 CCAACTCTATCCACTTGTTTTTG No data
Right 974211613 4:58783941-58783963 TAATTTTACTAAAGAGCATTTGG No data
974211612_974211613 -4 Left 974211612 4:58783922-58783944 CCACTTGTTTTTGTTGGCATAAT No data
Right 974211613 4:58783941-58783963 TAATTTTACTAAAGAGCATTTGG No data
974211606_974211613 27 Left 974211606 4:58783891-58783913 CCTTGCTAACCATATGCCCTGCC No data
Right 974211613 4:58783941-58783963 TAATTTTACTAAAGAGCATTTGG No data
974211607_974211613 18 Left 974211607 4:58783900-58783922 CCATATGCCCTGCCAACTCTATC No data
Right 974211613 4:58783941-58783963 TAATTTTACTAAAGAGCATTTGG No data
974211608_974211613 11 Left 974211608 4:58783907-58783929 CCCTGCCAACTCTATCCACTTGT No data
Right 974211613 4:58783941-58783963 TAATTTTACTAAAGAGCATTTGG No data
974211609_974211613 10 Left 974211609 4:58783908-58783930 CCTGCCAACTCTATCCACTTGTT No data
Right 974211613 4:58783941-58783963 TAATTTTACTAAAGAGCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974211613 Original CRISPR TAATTTTACTAAAGAGCATT TGG Intergenic
No off target data available for this crispr