ID: 974214626

View in Genome Browser
Species Human (GRCh38)
Location 4:58828986-58829008
Sequence GTTTCACAGTTCCACAGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974214621_974214626 29 Left 974214621 4:58828934-58828956 CCATAAAGAACTCTCTGAGACTG No data
Right 974214626 4:58828986-58829008 GTTTCACAGTTCCACAGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974214626 Original CRISPR GTTTCACAGTTCCACAGGAC TGG Intergenic
No off target data available for this crispr