ID: 974224361

View in Genome Browser
Species Human (GRCh38)
Location 4:59019227-59019249
Sequence AGAGAAAGCACAGTGATTGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974224361_974224366 14 Left 974224361 4:59019227-59019249 CCGACAATCACTGTGCTTTCTCT No data
Right 974224366 4:59019264-59019286 GATTCTCTCTGTGTGTCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974224361 Original CRISPR AGAGAAAGCACAGTGATTGT CGG (reversed) Intergenic
No off target data available for this crispr