ID: 974227837

View in Genome Browser
Species Human (GRCh38)
Location 4:59070656-59070678
Sequence CTTCCATCACTATTAGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974227837_974227838 -4 Left 974227837 4:59070656-59070678 CCTTGCTCTAATAGTGATGGAAG No data
Right 974227838 4:59070675-59070697 GAAGTTAATGAAGAATAAAGAGG No data
974227837_974227840 0 Left 974227837 4:59070656-59070678 CCTTGCTCTAATAGTGATGGAAG No data
Right 974227840 4:59070679-59070701 TTAATGAAGAATAAAGAGGGAGG No data
974227837_974227839 -3 Left 974227837 4:59070656-59070678 CCTTGCTCTAATAGTGATGGAAG No data
Right 974227839 4:59070676-59070698 AAGTTAATGAAGAATAAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974227837 Original CRISPR CTTCCATCACTATTAGAGCA AGG (reversed) Intergenic
No off target data available for this crispr