ID: 974229447

View in Genome Browser
Species Human (GRCh38)
Location 4:59091490-59091512
Sequence CAGTAAGCCCCTGCCACCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974229435_974229447 18 Left 974229435 4:59091449-59091471 CCATGGCTCCAGACCTGGACATC No data
Right 974229447 4:59091490-59091512 CAGTAAGCCCCTGCCACCGCAGG No data
974229442_974229447 -4 Left 974229442 4:59091471-59091493 CCCCGAGCTCTTGGGGGCCCAGT No data
Right 974229447 4:59091490-59091512 CAGTAAGCCCCTGCCACCGCAGG No data
974229436_974229447 10 Left 974229436 4:59091457-59091479 CCAGACCTGGACATCCCCGAGCT No data
Right 974229447 4:59091490-59091512 CAGTAAGCCCCTGCCACCGCAGG No data
974229433_974229447 23 Left 974229433 4:59091444-59091466 CCAAGCCATGGCTCCAGACCTGG No data
Right 974229447 4:59091490-59091512 CAGTAAGCCCCTGCCACCGCAGG No data
974229444_974229447 -6 Left 974229444 4:59091473-59091495 CCGAGCTCTTGGGGGCCCAGTAA No data
Right 974229447 4:59091490-59091512 CAGTAAGCCCCTGCCACCGCAGG No data
974229443_974229447 -5 Left 974229443 4:59091472-59091494 CCCGAGCTCTTGGGGGCCCAGTA No data
Right 974229447 4:59091490-59091512 CAGTAAGCCCCTGCCACCGCAGG No data
974229437_974229447 5 Left 974229437 4:59091462-59091484 CCTGGACATCCCCGAGCTCTTGG No data
Right 974229447 4:59091490-59091512 CAGTAAGCCCCTGCCACCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974229447 Original CRISPR CAGTAAGCCCCTGCCACCGC AGG Intergenic
No off target data available for this crispr