ID: 974231212

View in Genome Browser
Species Human (GRCh38)
Location 4:59116576-59116598
Sequence CATGAGAGGGACACAGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974231204_974231212 -5 Left 974231204 4:59116558-59116580 CCCATAATCCCCACATGTCATGA 0: 34
1: 434
2: 1317
3: 2689
4: 4374
Right 974231212 4:59116576-59116598 CATGAGAGGGACACAGTGGAAGG No data
974231202_974231212 21 Left 974231202 4:59116532-59116554 CCCAAATCTCATCTTAAATTATA 0: 42
1: 1261
2: 10000
3: 12756
4: 10545
Right 974231212 4:59116576-59116598 CATGAGAGGGACACAGTGGAAGG No data
974231203_974231212 20 Left 974231203 4:59116533-59116555 CCAAATCTCATCTTAAATTATAG 0: 14
1: 637
2: 5665
3: 9361
4: 11621
Right 974231212 4:59116576-59116598 CATGAGAGGGACACAGTGGAAGG No data
974231201_974231212 24 Left 974231201 4:59116529-59116551 CCACCCAAATCTCATCTTAAATT 0: 330
1: 8784
2: 12911
3: 10244
4: 8337
Right 974231212 4:59116576-59116598 CATGAGAGGGACACAGTGGAAGG No data
974231205_974231212 -6 Left 974231205 4:59116559-59116581 CCATAATCCCCACATGTCATGAG 0: 28
1: 435
2: 1292
3: 2696
4: 4222
Right 974231212 4:59116576-59116598 CATGAGAGGGACACAGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974231212 Original CRISPR CATGAGAGGGACACAGTGGA AGG Intergenic
No off target data available for this crispr