ID: 974233686

View in Genome Browser
Species Human (GRCh38)
Location 4:59152212-59152234
Sequence TTACTTCTTATCATAACAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974233686_974233688 8 Left 974233686 4:59152212-59152234 CCTGCTGTTATGATAAGAAGTAA No data
Right 974233688 4:59152243-59152265 ACTTGTAACCTAGCCATTGGAGG No data
974233686_974233687 5 Left 974233686 4:59152212-59152234 CCTGCTGTTATGATAAGAAGTAA No data
Right 974233687 4:59152240-59152262 TAAACTTGTAACCTAGCCATTGG No data
974233686_974233691 25 Left 974233686 4:59152212-59152234 CCTGCTGTTATGATAAGAAGTAA No data
Right 974233691 4:59152260-59152282 TGGAGGTTGCCCCAAAGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974233686 Original CRISPR TTACTTCTTATCATAACAGC AGG (reversed) Intergenic
No off target data available for this crispr