ID: 974233688

View in Genome Browser
Species Human (GRCh38)
Location 4:59152243-59152265
Sequence ACTTGTAACCTAGCCATTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974233686_974233688 8 Left 974233686 4:59152212-59152234 CCTGCTGTTATGATAAGAAGTAA No data
Right 974233688 4:59152243-59152265 ACTTGTAACCTAGCCATTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974233688 Original CRISPR ACTTGTAACCTAGCCATTGG AGG Intergenic
No off target data available for this crispr