ID: 974233691

View in Genome Browser
Species Human (GRCh38)
Location 4:59152260-59152282
Sequence TGGAGGTTGCCCCAAAGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974233686_974233691 25 Left 974233686 4:59152212-59152234 CCTGCTGTTATGATAAGAAGTAA No data
Right 974233691 4:59152260-59152282 TGGAGGTTGCCCCAAAGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974233691 Original CRISPR TGGAGGTTGCCCCAAAGACA AGG Intergenic
No off target data available for this crispr