ID: 974242686

View in Genome Browser
Species Human (GRCh38)
Location 4:59271418-59271440
Sequence CCACCATTTCAGTCTAAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974242681_974242686 9 Left 974242681 4:59271386-59271408 CCATCTTTTTGCGAATGGTCCCA No data
Right 974242686 4:59271418-59271440 CCACCATTTCAGTCTAAAGTAGG No data
974242682_974242686 -10 Left 974242682 4:59271405-59271427 CCCAGCTACTTTCCCACCATTTC No data
Right 974242686 4:59271418-59271440 CCACCATTTCAGTCTAAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974242686 Original CRISPR CCACCATTTCAGTCTAAAGT AGG Intergenic
No off target data available for this crispr