ID: 974245323

View in Genome Browser
Species Human (GRCh38)
Location 4:59307831-59307853
Sequence ATTGTCTCTTGGGGAATCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974245323_974245327 15 Left 974245323 4:59307831-59307853 CCTTTGATTCCCCAAGAGACAAT No data
Right 974245327 4:59307869-59307891 TTCATTTTTCTTATACTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974245323 Original CRISPR ATTGTCTCTTGGGGAATCAA AGG (reversed) Intergenic
No off target data available for this crispr