ID: 974249889

View in Genome Browser
Species Human (GRCh38)
Location 4:59372074-59372096
Sequence CTGGAGCAAAGCTTCTTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974249889_974249895 24 Left 974249889 4:59372074-59372096 CCCACAAAGAAGCTTTGCTCCAG No data
Right 974249895 4:59372121-59372143 AAGCATACCAATCTTCAGGATGG No data
974249889_974249894 20 Left 974249889 4:59372074-59372096 CCCACAAAGAAGCTTTGCTCCAG No data
Right 974249894 4:59372117-59372139 TGCTAAGCATACCAATCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974249889 Original CRISPR CTGGAGCAAAGCTTCTTTGT GGG (reversed) Intergenic
No off target data available for this crispr