ID: 974257759

View in Genome Browser
Species Human (GRCh38)
Location 4:59483687-59483709
Sequence TAGTCGTATTTTTAATTTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974257759_974257760 -4 Left 974257759 4:59483687-59483709 CCTAAAAATTAAAAATACGACTA No data
Right 974257760 4:59483706-59483728 ACTACCATATGATTCATTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974257759 Original CRISPR TAGTCGTATTTTTAATTTTT AGG (reversed) Intergenic
No off target data available for this crispr