ID: 974260384

View in Genome Browser
Species Human (GRCh38)
Location 4:59518383-59518405
Sequence TTGGATCCACAGCTGTGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974260377_974260384 4 Left 974260377 4:59518356-59518378 CCTGGGCCCCTGAGAGTGCAGAG 0: 8
1: 40
2: 81
3: 169
4: 740
Right 974260384 4:59518383-59518405 TTGGATCCACAGCTGTGGCAGGG No data
974260372_974260384 25 Left 974260372 4:59518335-59518357 CCCTGCAGGGGCAGGGGCCTTCC No data
Right 974260384 4:59518383-59518405 TTGGATCCACAGCTGTGGCAGGG No data
974260380_974260384 -4 Left 974260380 4:59518364-59518386 CCTGAGAGTGCAGAGATGCTTGG No data
Right 974260384 4:59518383-59518405 TTGGATCCACAGCTGTGGCAGGG No data
974260376_974260384 8 Left 974260376 4:59518352-59518374 CCTTCCTGGGCCCCTGAGAGTGC No data
Right 974260384 4:59518383-59518405 TTGGATCCACAGCTGTGGCAGGG No data
974260379_974260384 -3 Left 974260379 4:59518363-59518385 CCCTGAGAGTGCAGAGATGCTTG No data
Right 974260384 4:59518383-59518405 TTGGATCCACAGCTGTGGCAGGG No data
974260373_974260384 24 Left 974260373 4:59518336-59518358 CCTGCAGGGGCAGGGGCCTTCCT No data
Right 974260384 4:59518383-59518405 TTGGATCCACAGCTGTGGCAGGG No data
974260378_974260384 -2 Left 974260378 4:59518362-59518384 CCCCTGAGAGTGCAGAGATGCTT No data
Right 974260384 4:59518383-59518405 TTGGATCCACAGCTGTGGCAGGG No data
974260371_974260384 29 Left 974260371 4:59518331-59518353 CCAGCCCTGCAGGGGCAGGGGCC No data
Right 974260384 4:59518383-59518405 TTGGATCCACAGCTGTGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974260384 Original CRISPR TTGGATCCACAGCTGTGGCA GGG Intergenic
No off target data available for this crispr