ID: 974260460

View in Genome Browser
Species Human (GRCh38)
Location 4:59518681-59518703
Sequence TGCACCGAGGACTGCCGCGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974260460_974260468 30 Left 974260460 4:59518681-59518703 CCATCGCGGCAGTCCTCGGTGCA No data
Right 974260468 4:59518734-59518756 ACCCTCCCAGCAGTGGCCGCAGG No data
974260460_974260466 23 Left 974260460 4:59518681-59518703 CCATCGCGGCAGTCCTCGGTGCA No data
Right 974260466 4:59518727-59518749 TCTCCACACCCTCCCAGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974260460 Original CRISPR TGCACCGAGGACTGCCGCGA TGG (reversed) Intergenic