ID: 974261782

View in Genome Browser
Species Human (GRCh38)
Location 4:59534454-59534476
Sequence GCTAAACGAGCAACCAAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974261782_974261785 6 Left 974261782 4:59534454-59534476 CCTCCTTTGGTTGCTCGTTTAGC No data
Right 974261785 4:59534483-59534505 TCTTTGCTATCTCTTTACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974261782 Original CRISPR GCTAAACGAGCAACCAAAGG AGG (reversed) Intergenic
No off target data available for this crispr