ID: 974262374

View in Genome Browser
Species Human (GRCh38)
Location 4:59542299-59542321
Sequence AGTTATCTGCAGAAGATGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974262370_974262374 15 Left 974262370 4:59542261-59542283 CCAGTAACAGGCCAAGAGCTGTC 0: 162
1: 189
2: 129
3: 114
4: 178
Right 974262374 4:59542299-59542321 AGTTATCTGCAGAAGATGGTAGG No data
974262367_974262374 25 Left 974262367 4:59542251-59542273 CCACCAAAACCCAGTAACAGGCC No data
Right 974262374 4:59542299-59542321 AGTTATCTGCAGAAGATGGTAGG No data
974262372_974262374 4 Left 974262372 4:59542272-59542294 CCAAGAGCTGTCTCTCAAAAGGA 0: 181
1: 197
2: 163
3: 130
4: 293
Right 974262374 4:59542299-59542321 AGTTATCTGCAGAAGATGGTAGG No data
974262369_974262374 16 Left 974262369 4:59542260-59542282 CCCAGTAACAGGCCAAGAGCTGT 0: 174
1: 194
2: 145
3: 123
4: 215
Right 974262374 4:59542299-59542321 AGTTATCTGCAGAAGATGGTAGG No data
974262368_974262374 22 Left 974262368 4:59542254-59542276 CCAAAACCCAGTAACAGGCCAAG No data
Right 974262374 4:59542299-59542321 AGTTATCTGCAGAAGATGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974262374 Original CRISPR AGTTATCTGCAGAAGATGGT AGG Intergenic
No off target data available for this crispr