ID: 974266136

View in Genome Browser
Species Human (GRCh38)
Location 4:59588067-59588089
Sequence GTTCACTGGATGCCAAAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974266136_974266140 24 Left 974266136 4:59588067-59588089 CCCTTTTTTGGCATCCAGTGAAC No data
Right 974266140 4:59588114-59588136 ACTACACAAACAGAGTTGATTGG No data
974266136_974266141 27 Left 974266136 4:59588067-59588089 CCCTTTTTTGGCATCCAGTGAAC No data
Right 974266141 4:59588117-59588139 ACACAAACAGAGTTGATTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974266136 Original CRISPR GTTCACTGGATGCCAAAAAA GGG (reversed) Intergenic
No off target data available for this crispr