ID: 974266141

View in Genome Browser
Species Human (GRCh38)
Location 4:59588117-59588139
Sequence ACACAAACAGAGTTGATTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974266137_974266141 26 Left 974266137 4:59588068-59588090 CCTTTTTTGGCATCCAGTGAACC No data
Right 974266141 4:59588117-59588139 ACACAAACAGAGTTGATTGGAGG No data
974266136_974266141 27 Left 974266136 4:59588067-59588089 CCCTTTTTTGGCATCCAGTGAAC No data
Right 974266141 4:59588117-59588139 ACACAAACAGAGTTGATTGGAGG No data
974266139_974266141 5 Left 974266139 4:59588089-59588111 CCATATTATGAACTCACTAAATA No data
Right 974266141 4:59588117-59588139 ACACAAACAGAGTTGATTGGAGG No data
974266135_974266141 28 Left 974266135 4:59588066-59588088 CCCCTTTTTTGGCATCCAGTGAA No data
Right 974266141 4:59588117-59588139 ACACAAACAGAGTTGATTGGAGG No data
974266138_974266141 13 Left 974266138 4:59588081-59588103 CCAGTGAACCATATTATGAACTC No data
Right 974266141 4:59588117-59588139 ACACAAACAGAGTTGATTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974266141 Original CRISPR ACACAAACAGAGTTGATTGG AGG Intergenic
No off target data available for this crispr