ID: 974273946

View in Genome Browser
Species Human (GRCh38)
Location 4:59690530-59690552
Sequence TCCATTACACAGATGATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974273942_974273946 10 Left 974273942 4:59690497-59690519 CCTCAGAGGTCAAAATGTGGCTT No data
Right 974273946 4:59690530-59690552 TCCATTACACAGATGATGGAAGG No data
974273941_974273946 11 Left 974273941 4:59690496-59690518 CCCTCAGAGGTCAAAATGTGGCT No data
Right 974273946 4:59690530-59690552 TCCATTACACAGATGATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974273946 Original CRISPR TCCATTACACAGATGATGGA AGG Intergenic
No off target data available for this crispr