ID: 974274443

View in Genome Browser
Species Human (GRCh38)
Location 4:59699581-59699603
Sequence GAGGCAAATTTTCAGTTTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974274434_974274443 30 Left 974274434 4:59699528-59699550 CCCAAACAGTGGTTCATGGACTG No data
Right 974274443 4:59699581-59699603 GAGGCAAATTTTCAGTTTGTAGG No data
974274435_974274443 29 Left 974274435 4:59699529-59699551 CCAAACAGTGGTTCATGGACTGG No data
Right 974274443 4:59699581-59699603 GAGGCAAATTTTCAGTTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974274443 Original CRISPR GAGGCAAATTTTCAGTTTGT AGG Intergenic
No off target data available for this crispr