ID: 974280037

View in Genome Browser
Species Human (GRCh38)
Location 4:59780514-59780536
Sequence GCAGCCAGGAAGTTTGAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974280032_974280037 27 Left 974280032 4:59780464-59780486 CCACCATTGCTGAGGTTGGAGCT No data
Right 974280037 4:59780514-59780536 GCAGCCAGGAAGTTTGAACTGGG No data
974280033_974280037 24 Left 974280033 4:59780467-59780489 CCATTGCTGAGGTTGGAGCTAGA No data
Right 974280037 4:59780514-59780536 GCAGCCAGGAAGTTTGAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974280037 Original CRISPR GCAGCCAGGAAGTTTGAACT GGG Intergenic
No off target data available for this crispr