ID: 974289565

View in Genome Browser
Species Human (GRCh38)
Location 4:59912712-59912734
Sequence AGTTAACTGTAGAAGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974289565_974289572 22 Left 974289565 4:59912712-59912734 CCTGCCATCTTCTACAGTTAACT No data
Right 974289572 4:59912757-59912779 CTTGGCTTGTCACTGGGCTTTGG No data
974289565_974289570 15 Left 974289565 4:59912712-59912734 CCTGCCATCTTCTACAGTTAACT No data
Right 974289570 4:59912750-59912772 AATAGCTCTTGGCTTGTCACTGG No data
974289565_974289569 4 Left 974289565 4:59912712-59912734 CCTGCCATCTTCTACAGTTAACT No data
Right 974289569 4:59912739-59912761 TTCTTTTGAGAAATAGCTCTTGG No data
974289565_974289571 16 Left 974289565 4:59912712-59912734 CCTGCCATCTTCTACAGTTAACT No data
Right 974289571 4:59912751-59912773 ATAGCTCTTGGCTTGTCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974289565 Original CRISPR AGTTAACTGTAGAAGATGGC AGG (reversed) Intergenic
No off target data available for this crispr