ID: 974289608

View in Genome Browser
Species Human (GRCh38)
Location 4:59913027-59913049
Sequence CCCCATGAGGTCATCAGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974289608_974289611 3 Left 974289608 4:59913027-59913049 CCTGCACTGATGACCTCATGGGG No data
Right 974289611 4:59913053-59913075 TCCCTATAATCAGTTGACAAAGG No data
974289608_974289614 23 Left 974289608 4:59913027-59913049 CCTGCACTGATGACCTCATGGGG No data
Right 974289614 4:59913073-59913095 AGGAAGAGAAGACTAGAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974289608 Original CRISPR CCCCATGAGGTCATCAGTGC AGG (reversed) Intergenic
No off target data available for this crispr