ID: 974297377

View in Genome Browser
Species Human (GRCh38)
Location 4:60019156-60019178
Sequence TGGGACTCTATGGGAGAATC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974297368_974297377 29 Left 974297368 4:60019104-60019126 CCATATGAAGATAAAATGAAGGC No data
Right 974297377 4:60019156-60019178 TGGGACTCTATGGGAGAATCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974297377 Original CRISPR TGGGACTCTATGGGAGAATC GGG Intergenic
No off target data available for this crispr