ID: 974300526

View in Genome Browser
Species Human (GRCh38)
Location 4:60060105-60060127
Sequence TACACTGCTCACATTCATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974300524_974300526 -3 Left 974300524 4:60060085-60060107 CCTTGCTTGTGACTTCTGTTTAC No data
Right 974300526 4:60060105-60060127 TACACTGCTCACATTCATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974300526 Original CRISPR TACACTGCTCACATTCATAT GGG Intergenic
No off target data available for this crispr