ID: 974304618

View in Genome Browser
Species Human (GRCh38)
Location 4:60117631-60117653
Sequence TCTTACAAGGTGATGGTAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974304618_974304623 26 Left 974304618 4:60117631-60117653 CCTACTACCATCACCTTGTAAGA No data
Right 974304623 4:60117680-60117702 CACAAACATTTTGATTACAATGG No data
974304618_974304621 -2 Left 974304618 4:60117631-60117653 CCTACTACCATCACCTTGTAAGA No data
Right 974304621 4:60117652-60117674 GAATTTCAGCATATGCATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974304618 Original CRISPR TCTTACAAGGTGATGGTAGT AGG (reversed) Intergenic
No off target data available for this crispr