ID: 974304619

View in Genome Browser
Species Human (GRCh38)
Location 4:60117638-60117660
Sequence CTGAAATTCTTACAAGGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974304619_974304623 19 Left 974304619 4:60117638-60117660 CCATCACCTTGTAAGAATTTCAG No data
Right 974304623 4:60117680-60117702 CACAAACATTTTGATTACAATGG No data
974304619_974304621 -9 Left 974304619 4:60117638-60117660 CCATCACCTTGTAAGAATTTCAG No data
Right 974304621 4:60117652-60117674 GAATTTCAGCATATGCATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974304619 Original CRISPR CTGAAATTCTTACAAGGTGA TGG (reversed) Intergenic
No off target data available for this crispr