ID: 974306142

View in Genome Browser
Species Human (GRCh38)
Location 4:60142751-60142773
Sequence GAGTCCATACAGATGGAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974306139_974306142 2 Left 974306139 4:60142726-60142748 CCCAAAGTGTAAAGCAAATATCT No data
Right 974306142 4:60142751-60142773 GAGTCCATACAGATGGAACCTGG No data
974306140_974306142 1 Left 974306140 4:60142727-60142749 CCAAAGTGTAAAGCAAATATCTA No data
Right 974306142 4:60142751-60142773 GAGTCCATACAGATGGAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974306142 Original CRISPR GAGTCCATACAGATGGAACC TGG Intergenic
No off target data available for this crispr