ID: 974309559

View in Genome Browser
Species Human (GRCh38)
Location 4:60187499-60187521
Sequence CACTGCAAGCTGAAGTGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974309554_974309559 17 Left 974309554 4:60187459-60187481 CCAGTCTCAGTGGTTGGAACTTG No data
Right 974309559 4:60187499-60187521 CACTGCAAGCTGAAGTGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974309559 Original CRISPR CACTGCAAGCTGAAGTGCTC TGG Intergenic
No off target data available for this crispr