ID: 974310395

View in Genome Browser
Species Human (GRCh38)
Location 4:60200889-60200911
Sequence AAGTGGAGGGGGAGGTTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974310395_974310402 -2 Left 974310395 4:60200889-60200911 CCAGGAAACCTCCCCCTCCACTT No data
Right 974310402 4:60200910-60200932 TTCATTCTGATTCAGTATATCGG No data
974310395_974310405 26 Left 974310395 4:60200889-60200911 CCAGGAAACCTCCCCCTCCACTT No data
Right 974310405 4:60200938-60200960 GGATTAGATAATTTTGATGCAGG No data
974310395_974310406 29 Left 974310395 4:60200889-60200911 CCAGGAAACCTCCCCCTCCACTT No data
Right 974310406 4:60200941-60200963 TTAGATAATTTTGATGCAGGTGG No data
974310395_974310403 1 Left 974310395 4:60200889-60200911 CCAGGAAACCTCCCCCTCCACTT No data
Right 974310403 4:60200913-60200935 ATTCTGATTCAGTATATCGGTGG No data
974310395_974310404 5 Left 974310395 4:60200889-60200911 CCAGGAAACCTCCCCCTCCACTT No data
Right 974310404 4:60200917-60200939 TGATTCAGTATATCGGTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974310395 Original CRISPR AAGTGGAGGGGGAGGTTTCC TGG (reversed) Intergenic
No off target data available for this crispr