ID: 974310396

View in Genome Browser
Species Human (GRCh38)
Location 4:60200897-60200919
Sequence TCAGAATGAAGTGGAGGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974310396_974310405 18 Left 974310396 4:60200897-60200919 CCTCCCCCTCCACTTCATTCTGA No data
Right 974310405 4:60200938-60200960 GGATTAGATAATTTTGATGCAGG No data
974310396_974310404 -3 Left 974310396 4:60200897-60200919 CCTCCCCCTCCACTTCATTCTGA No data
Right 974310404 4:60200917-60200939 TGATTCAGTATATCGGTGGTTGG No data
974310396_974310402 -10 Left 974310396 4:60200897-60200919 CCTCCCCCTCCACTTCATTCTGA No data
Right 974310402 4:60200910-60200932 TTCATTCTGATTCAGTATATCGG No data
974310396_974310403 -7 Left 974310396 4:60200897-60200919 CCTCCCCCTCCACTTCATTCTGA No data
Right 974310403 4:60200913-60200935 ATTCTGATTCAGTATATCGGTGG No data
974310396_974310406 21 Left 974310396 4:60200897-60200919 CCTCCCCCTCCACTTCATTCTGA No data
Right 974310406 4:60200941-60200963 TTAGATAATTTTGATGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974310396 Original CRISPR TCAGAATGAAGTGGAGGGGG AGG (reversed) Intergenic
No off target data available for this crispr