ID: 974310398

View in Genome Browser
Species Human (GRCh38)
Location 4:60200901-60200923
Sequence TGAATCAGAATGAAGTGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974310398_974310404 -7 Left 974310398 4:60200901-60200923 CCCCTCCACTTCATTCTGATTCA No data
Right 974310404 4:60200917-60200939 TGATTCAGTATATCGGTGGTTGG No data
974310398_974310406 17 Left 974310398 4:60200901-60200923 CCCCTCCACTTCATTCTGATTCA No data
Right 974310406 4:60200941-60200963 TTAGATAATTTTGATGCAGGTGG No data
974310398_974310405 14 Left 974310398 4:60200901-60200923 CCCCTCCACTTCATTCTGATTCA No data
Right 974310405 4:60200938-60200960 GGATTAGATAATTTTGATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974310398 Original CRISPR TGAATCAGAATGAAGTGGAG GGG (reversed) Intergenic
No off target data available for this crispr