ID: 974310400

View in Genome Browser
Species Human (GRCh38)
Location 4:60200903-60200925
Sequence ACTGAATCAGAATGAAGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974310400_974310405 12 Left 974310400 4:60200903-60200925 CCTCCACTTCATTCTGATTCAGT No data
Right 974310405 4:60200938-60200960 GGATTAGATAATTTTGATGCAGG No data
974310400_974310406 15 Left 974310400 4:60200903-60200925 CCTCCACTTCATTCTGATTCAGT No data
Right 974310406 4:60200941-60200963 TTAGATAATTTTGATGCAGGTGG No data
974310400_974310404 -9 Left 974310400 4:60200903-60200925 CCTCCACTTCATTCTGATTCAGT No data
Right 974310404 4:60200917-60200939 TGATTCAGTATATCGGTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974310400 Original CRISPR ACTGAATCAGAATGAAGTGG AGG (reversed) Intergenic
No off target data available for this crispr