ID: 974310401

View in Genome Browser
Species Human (GRCh38)
Location 4:60200906-60200928
Sequence TATACTGAATCAGAATGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974310401_974310406 12 Left 974310401 4:60200906-60200928 CCACTTCATTCTGATTCAGTATA No data
Right 974310406 4:60200941-60200963 TTAGATAATTTTGATGCAGGTGG No data
974310401_974310405 9 Left 974310401 4:60200906-60200928 CCACTTCATTCTGATTCAGTATA No data
Right 974310405 4:60200938-60200960 GGATTAGATAATTTTGATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974310401 Original CRISPR TATACTGAATCAGAATGAAG TGG (reversed) Intergenic
No off target data available for this crispr