ID: 974310406

View in Genome Browser
Species Human (GRCh38)
Location 4:60200941-60200963
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974310395_974310406 29 Left 974310395 4:60200889-60200911 CCAGGAAACCTCCCCCTCCACTT No data
Right 974310406 4:60200941-60200963 TTAGATAATTTTGATGCAGGTGG No data
974310398_974310406 17 Left 974310398 4:60200901-60200923 CCCCTCCACTTCATTCTGATTCA No data
Right 974310406 4:60200941-60200963 TTAGATAATTTTGATGCAGGTGG No data
974310399_974310406 16 Left 974310399 4:60200902-60200924 CCCTCCACTTCATTCTGATTCAG No data
Right 974310406 4:60200941-60200963 TTAGATAATTTTGATGCAGGTGG No data
974310397_974310406 18 Left 974310397 4:60200900-60200922 CCCCCTCCACTTCATTCTGATTC No data
Right 974310406 4:60200941-60200963 TTAGATAATTTTGATGCAGGTGG No data
974310396_974310406 21 Left 974310396 4:60200897-60200919 CCTCCCCCTCCACTTCATTCTGA No data
Right 974310406 4:60200941-60200963 TTAGATAATTTTGATGCAGGTGG No data
974310401_974310406 12 Left 974310401 4:60200906-60200928 CCACTTCATTCTGATTCAGTATA No data
Right 974310406 4:60200941-60200963 TTAGATAATTTTGATGCAGGTGG No data
974310400_974310406 15 Left 974310400 4:60200903-60200925 CCTCCACTTCATTCTGATTCAGT No data
Right 974310406 4:60200941-60200963 TTAGATAATTTTGATGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr