ID: 974313625

View in Genome Browser
Species Human (GRCh38)
Location 4:60247350-60247372
Sequence CAGAATATACATATAGACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974313623_974313625 28 Left 974313623 4:60247299-60247321 CCAAGTAAAGGATTTATCTGGGA No data
Right 974313625 4:60247350-60247372 CAGAATATACATATAGACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974313625 Original CRISPR CAGAATATACATATAGACCA GGG Intergenic
No off target data available for this crispr