ID: 974318267

View in Genome Browser
Species Human (GRCh38)
Location 4:60310142-60310164
Sequence CCAGTAAGAGGCAGAACTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974318267_974318271 -3 Left 974318267 4:60310142-60310164 CCAACAGTTCTGCCTCTTACTGG No data
Right 974318271 4:60310162-60310184 TGGGTAGAATAATGTAATTTAGG No data
974318267_974318274 14 Left 974318267 4:60310142-60310164 CCAACAGTTCTGCCTCTTACTGG No data
Right 974318274 4:60310179-60310201 TTTAGGAAGGCAAAATGTGAGGG No data
974318267_974318272 1 Left 974318267 4:60310142-60310164 CCAACAGTTCTGCCTCTTACTGG No data
Right 974318272 4:60310166-60310188 TAGAATAATGTAATTTAGGAAGG No data
974318267_974318273 13 Left 974318267 4:60310142-60310164 CCAACAGTTCTGCCTCTTACTGG No data
Right 974318273 4:60310178-60310200 ATTTAGGAAGGCAAAATGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974318267 Original CRISPR CCAGTAAGAGGCAGAACTGT TGG (reversed) Intergenic
No off target data available for this crispr