ID: 974320156

View in Genome Browser
Species Human (GRCh38)
Location 4:60337114-60337136
Sequence TTCTTTCTGGCTAGAGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974320150_974320156 9 Left 974320150 4:60337082-60337104 CCAAATATAGATATATTTATTGG No data
Right 974320156 4:60337114-60337136 TTCTTTCTGGCTAGAGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974320156 Original CRISPR TTCTTTCTGGCTAGAGAGGA TGG Intergenic
No off target data available for this crispr