ID: 974334967

View in Genome Browser
Species Human (GRCh38)
Location 4:60530767-60530789
Sequence ATCTAATTCCAGGAGTTTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974334967_974334969 3 Left 974334967 4:60530767-60530789 CCATAAAACTCCTGGAATTAGAT No data
Right 974334969 4:60530793-60530815 AATATAGAGTATTACATTATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974334967 Original CRISPR ATCTAATTCCAGGAGTTTTA TGG (reversed) Intergenic
No off target data available for this crispr