ID: 974346438

View in Genome Browser
Species Human (GRCh38)
Location 4:60688136-60688158
Sequence TTACCTCAGGCCAGGCTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974346435_974346438 16 Left 974346435 4:60688097-60688119 CCTGTTCTCAATGGATTTCACAA No data
Right 974346438 4:60688136-60688158 TTACCTCAGGCCAGGCTGTCTGG No data
974346434_974346438 23 Left 974346434 4:60688090-60688112 CCACTGACCTGTTCTCAATGGAT No data
Right 974346438 4:60688136-60688158 TTACCTCAGGCCAGGCTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974346438 Original CRISPR TTACCTCAGGCCAGGCTGTC TGG Intergenic
No off target data available for this crispr