ID: 974348443

View in Genome Browser
Species Human (GRCh38)
Location 4:60713329-60713351
Sequence CAGTGAAAGGAAAAGGAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974348438_974348443 10 Left 974348438 4:60713296-60713318 CCTTATCACAAGTATCACAAGTA No data
Right 974348443 4:60713329-60713351 CAGTGAAAGGAAAAGGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974348443 Original CRISPR CAGTGAAAGGAAAAGGAAAC AGG Intergenic
No off target data available for this crispr