ID: 974352057

View in Genome Browser
Species Human (GRCh38)
Location 4:60761132-60761154
Sequence CAGGTGTGGAGAGAGTTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974352057_974352061 0 Left 974352057 4:60761132-60761154 CCAGAAAACTCTCTCCACACCTG No data
Right 974352061 4:60761155-60761177 CACAGAGGAAAAGCCATATGAGG No data
974352057_974352063 16 Left 974352057 4:60761132-60761154 CCAGAAAACTCTCTCCACACCTG No data
Right 974352063 4:60761171-60761193 TATGAGGATACAGTGAAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974352057 Original CRISPR CAGGTGTGGAGAGAGTTTTC TGG (reversed) Intergenic