ID: 974352057 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:60761132-60761154 |
Sequence | CAGGTGTGGAGAGAGTTTTC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
974352057_974352061 | 0 | Left | 974352057 | 4:60761132-60761154 | CCAGAAAACTCTCTCCACACCTG | No data | ||
Right | 974352061 | 4:60761155-60761177 | CACAGAGGAAAAGCCATATGAGG | No data | ||||
974352057_974352063 | 16 | Left | 974352057 | 4:60761132-60761154 | CCAGAAAACTCTCTCCACACCTG | No data | ||
Right | 974352063 | 4:60761171-60761193 | TATGAGGATACAGTGAAATGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
974352057 | Original CRISPR | CAGGTGTGGAGAGAGTTTTC TGG (reversed) | Intergenic | ||