ID: 974352059

View in Genome Browser
Species Human (GRCh38)
Location 4:60761146-60761168
Sequence GCTTTTCCTCTGTGCAGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974352059_974352064 26 Left 974352059 4:60761146-60761168 CCACACCTGCACAGAGGAAAAGC No data
Right 974352064 4:60761195-60761217 CATCTACAAACCAATAATAGAGG No data
974352059_974352063 2 Left 974352059 4:60761146-60761168 CCACACCTGCACAGAGGAAAAGC No data
Right 974352063 4:60761171-60761193 TATGAGGATACAGTGAAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974352059 Original CRISPR GCTTTTCCTCTGTGCAGGTG TGG (reversed) Intergenic