ID: 974352059 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:60761146-60761168 |
Sequence | GCTTTTCCTCTGTGCAGGTG TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
974352059_974352064 | 26 | Left | 974352059 | 4:60761146-60761168 | CCACACCTGCACAGAGGAAAAGC | No data | ||
Right | 974352064 | 4:60761195-60761217 | CATCTACAAACCAATAATAGAGG | No data | ||||
974352059_974352063 | 2 | Left | 974352059 | 4:60761146-60761168 | CCACACCTGCACAGAGGAAAAGC | No data | ||
Right | 974352063 | 4:60761171-60761193 | TATGAGGATACAGTGAAATGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
974352059 | Original CRISPR | GCTTTTCCTCTGTGCAGGTG TGG (reversed) | Intergenic | ||