ID: 974352060

View in Genome Browser
Species Human (GRCh38)
Location 4:60761151-60761173
Sequence ATATGGCTTTTCCTCTGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974352060_974352063 -3 Left 974352060 4:60761151-60761173 CCTGCACAGAGGAAAAGCCATAT No data
Right 974352063 4:60761171-60761193 TATGAGGATACAGTGAAATGTGG No data
974352060_974352064 21 Left 974352060 4:60761151-60761173 CCTGCACAGAGGAAAAGCCATAT No data
Right 974352064 4:60761195-60761217 CATCTACAAACCAATAATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974352060 Original CRISPR ATATGGCTTTTCCTCTGTGC AGG (reversed) Intergenic