ID: 974352060 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:60761151-60761173 |
| Sequence | ATATGGCTTTTCCTCTGTGC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 974352060_974352063 | -3 | Left | 974352060 | 4:60761151-60761173 | CCTGCACAGAGGAAAAGCCATAT | No data | ||
| Right | 974352063 | 4:60761171-60761193 | TATGAGGATACAGTGAAATGTGG | No data | ||||
| 974352060_974352064 | 21 | Left | 974352060 | 4:60761151-60761173 | CCTGCACAGAGGAAAAGCCATAT | No data | ||
| Right | 974352064 | 4:60761195-60761217 | CATCTACAAACCAATAATAGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 974352060 | Original CRISPR | ATATGGCTTTTCCTCTGTGC AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||