ID: 974352063

View in Genome Browser
Species Human (GRCh38)
Location 4:60761171-60761193
Sequence TATGAGGATACAGTGAAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974352060_974352063 -3 Left 974352060 4:60761151-60761173 CCTGCACAGAGGAAAAGCCATAT No data
Right 974352063 4:60761171-60761193 TATGAGGATACAGTGAAATGTGG No data
974352057_974352063 16 Left 974352057 4:60761132-60761154 CCAGAAAACTCTCTCCACACCTG No data
Right 974352063 4:60761171-60761193 TATGAGGATACAGTGAAATGTGG No data
974352059_974352063 2 Left 974352059 4:60761146-60761168 CCACACCTGCACAGAGGAAAAGC No data
Right 974352063 4:60761171-60761193 TATGAGGATACAGTGAAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974352063 Original CRISPR TATGAGGATACAGTGAAATG TGG Intergenic
No off target data available for this crispr