ID: 974352064

View in Genome Browser
Species Human (GRCh38)
Location 4:60761195-60761217
Sequence CATCTACAAACCAATAATAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974352060_974352064 21 Left 974352060 4:60761151-60761173 CCTGCACAGAGGAAAAGCCATAT No data
Right 974352064 4:60761195-60761217 CATCTACAAACCAATAATAGAGG No data
974352062_974352064 4 Left 974352062 4:60761168-60761190 CCATATGAGGATACAGTGAAATG No data
Right 974352064 4:60761195-60761217 CATCTACAAACCAATAATAGAGG No data
974352059_974352064 26 Left 974352059 4:60761146-60761168 CCACACCTGCACAGAGGAAAAGC No data
Right 974352064 4:60761195-60761217 CATCTACAAACCAATAATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974352064 Original CRISPR CATCTACAAACCAATAATAG AGG Intergenic
No off target data available for this crispr