ID: 974355886

View in Genome Browser
Species Human (GRCh38)
Location 4:60812252-60812274
Sequence CAAGATGGGCTCCTTGATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974355886_974355892 14 Left 974355886 4:60812252-60812274 CCAAGATCAAGGAGCCCATCTTG No data
Right 974355892 4:60812289-60812311 TTGTGTCATCTTGTGGCAAAAGG No data
974355886_974355891 7 Left 974355886 4:60812252-60812274 CCAAGATCAAGGAGCCCATCTTG No data
Right 974355891 4:60812282-60812304 CTTCTTATTGTGTCATCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974355886 Original CRISPR CAAGATGGGCTCCTTGATCT TGG (reversed) Intergenic
No off target data available for this crispr