ID: 974356124

View in Genome Browser
Species Human (GRCh38)
Location 4:60814786-60814808
Sequence ACCATGGGCCGTTTGCTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974356119_974356124 -5 Left 974356119 4:60814768-60814790 CCCACGCAGCCTGCAGGCACCAT No data
Right 974356124 4:60814786-60814808 ACCATGGGCCGTTTGCTCTGTGG No data
974356120_974356124 -6 Left 974356120 4:60814769-60814791 CCACGCAGCCTGCAGGCACCATG No data
Right 974356124 4:60814786-60814808 ACCATGGGCCGTTTGCTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974356124 Original CRISPR ACCATGGGCCGTTTGCTCTG TGG Intergenic
No off target data available for this crispr